Lab Simulation – Gene Sequence Comparison using BLAST

Simulation Tool:

NCBI BLAST (Basic Local Alignment Search Tool)
🔗 https://blast.ncbi.nlm.nih.gov/Blast.cgi

Instructions:

1. Go to the BLAST homepage: https://blast.ncbi.nlm.nih.gov/Blast.cgi

2. Click on “nucleotide BLAST” under the “Basic BLAST” section.

3. In the “Enter Query Sequence” box, paste the following sample DNA sequence:

    

   ATGGAATTCAAGGAGATATAACAATGGCAGGAAGATGAGGAGGACGAAGAAGCAGGAGTGGAGGAAGAGG

4. Under “Database”, select:

   • “Nucleotide collection (nr/nt)”

5. Leave all other settings as default, and click “BLAST” at the bottom.

6. Once the results are generated:

   • Scroll to the Descriptions and Alignments sections.

   • Identify the organism from which the top hit is derived.

   • Record the % identity, E-value, and alignment length.

Student Task:

Submit a short lab report that includes:

• A screenshot of your BLAST results.

• A summary of the organism matched, with:

  • Scientific name

  • % identity

  • E-value

  • Function of the matched gene (if available)

• A short reflection (100–150 words) on how BLAST can be useful in genetics and medicine.

Submission Instructions:

• Upload as: PDF or Word document

• File Name Format: YourName_BLAST_Report